phylip is an actively used text data format created in 1991. The PHYLIP file format stores a multiple sequence alignment. The format was originally defined and used in Joe Felsenstein’s PHYLIP package [R165], and has since been supported by several other bioinformatics tools

29Years Old ?Users ?Jobs
  • phylip first appeared in 1991
  • file extensions for phylip include phy and ph
  • Have a question about phylip not answered here? Email me and let me know how I can help.

Example code from the web:

3 30
Taxon1     ACCGTTTCCACAGCATTATGG
GCTCGATGA
Taxon2     CACTTCACAAATCAATATTGA
GCTAGTGCA
Taxon3     TAAGGTATTGGGCTTGGTTCG
CAGGGGACT

Last updated June 22nd, 2020

Edit phylip on GitHub