FASTQ format

FASTQ format is an actively used text data format created in 2000. FASTQ format is a text-based format for storing both a biological sequence (usually nucleotide sequence) and its corresponding quality scores. Both the sequence letter and quality score are each encoded with a single ASCII character for brevity. It was originally developed at the Wellcome Trust Sanger Institute to bundle a FASTA formatted sequence and its quality data, but has recently become the de facto standard for storing the output of high-throughput sequencing instruments such as the Illumina Genome Analyzer.. Read more on Wikipedia...

19Years Old

20Users

0Jobs

• FASTQ format ranks in the top 50% of languages
• the FASTQ format wikipedia page
• FASTQ format first appeared in 2000
• See also: ascii, fasta-format
• I have 33 facts about FASTQ format. what would you like to know? email me and let me know how I can help.

Example code from the web:

@SEQ_ID
GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT
+
!''*((((***+))%%%++)(%%%%).1***-+*''))**55CCF>>>>>>CCCCCCC65

Example code from Wikipedia:

sed -e 'n;n;n;y/!"#$%&'\''()*+,-.\/0123456789:;<=>?@ABCDEFGHIJKL/▁▁▁▁▁▁▁▁▂▂▂▂▂▃▃▃▃▃▄▄▄▄▄▅▅▅▅▅▆▆▆▆▆▇▇▇▇▇██████/' myfile.fastq   # add -i to save the result to the same input file

Last updated October 20th, 2019