FASTQ format
FASTQ format is an actively used text data format created in 2000. FASTQ format is a text-based format for storing both a biological sequence (usually nucleotide sequence) and its corresponding quality scores. Both the sequence letter and quality score are each encoded with a single ASCII character for brevity. It was originally developed at the Wellcome Trust Sanger Institute to bundle a FASTA formatted sequence and its quality data, but has recently become the de facto standard for storing the output of high-throughput sequencing instruments such as the Illumina Genome Analyzer.. Read more on Wikipedia...
20Years Old | 20Users | ?Jobs |
- FASTQ format ranks in the top 25% of languages
- the FASTQ format wikipedia page
- FASTQ format first appeared in 2000
- See also: ascii, fasta-format
- Have a question about FASTQ format not answered here? Email me and let me know how I can help.
Example code from the web:
@SEQ_ID GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT + !''*((((***+))%%%++)(%%%%).1***-+*''))**55CCF>>>>>>CCCCCCC65
Example code from Wikipedia:
sed -e 'n;n;n;y/!"#$%&'\''()*+,-.\/0123456789:;<=>?@ABCDEFGHIJKL/▁▁▁▁▁▁▁▁▂▂▂▂▂▃▃▃▃▃▄▄▄▄▄▅▅▅▅▅▆▆▆▆▆▇▇▇▇▇██████/' myfile.fastq # add -i to save the result to the same input file
Last updated August 9th, 2020